You are using an unsupported browser. Please upgrade your browser to a newer version to get the best experience on Human Metabolome Database.
Identification
HMDB Protein ID HMDBP10830
Secondary Accession Numbers
  • 17117
Name V1-vascular vasopressin receptor AVPR1A
Synonyms Not Available
Gene Name Not Available
Protein Type Unknown
Biological Properties
General Function Involved in receptor activity
Specific Function Not Available
Pathways Not Available
Reactions Not Available
GO Classification Not Available
Cellular Location Not Available
Gene Properties
Chromosome Location Not Available
Locus Not Available
SNPs Not Available
Gene Sequence
>32 bp
ATGCGTCTCTCCGCCGGTCCCGACGCGGGGCC
Protein Properties
Number of Residues 11
Molecular Weight 1071.2
Theoretical pI 6.23
Pfam Domain Function Not Available
Signals
  • None
Transmembrane Regions
  • None
Protein Sequence
>V1-vascular vasopressin receptor AVPR1A
MRLSAGPDAGP
GenBank ID Protein Not Available
UniProtKB/Swiss-Prot ID Q9UH72
UniProtKB/Swiss-Prot Entry Name Q9UH72_HUMAN
PDB IDs Not Available
GenBank Gene ID AF208541
GeneCard ID Not Available
GenAtlas ID Not Available
HGNC ID Not Available
References
General References
  1. Thibonnier M, Graves MK, Wagner MS, Chatelain N, Soubrier F, Corvol P, Willard HF, Jeunemaitre X: Study of V(1)-vascular vasopressin receptor gene microsatellite polymorphisms in human essential hypertension. J Mol Cell Cardiol. 2000 Apr;32(4):557-64. [PubMed:10756113 ]