You are using an unsupported browser. Please upgrade your browser to a newer version to get the best experience on Human Metabolome Database.
Showing Protein Arginine vasopressin V2 receptor (HMDBP10831)
Identification | |
---|---|
HMDB Protein ID | HMDBP10831 |
Secondary Accession Numbers |
|
Name | Arginine vasopressin V2 receptor |
Synonyms | Not Available |
Gene Name | Not Available |
Protein Type | Unknown |
Biological Properties | |
General Function | Involved in receptor activity |
Specific Function | Not Available |
Pathways | Not Available |
Reactions | Not Available |
GO Classification | Not Available |
Cellular Location | Not Available |
Gene Properties | |
Chromosome Location | Not Available |
Locus | Not Available |
SNPs | Not Available |
Gene Sequence |
>57 bp GTGCCTGGGCATCCCTCTCTGCCCAGCTGTGCCTGGGCATCCCTCTCTGCCCAGCCT |
Protein Properties | |
Number of Residues | 19 |
Molecular Weight | 1905.1 |
Theoretical pI | 7.36 |
Pfam Domain Function | Not Available |
Signals |
|
Transmembrane Regions |
|
Protein Sequence |
>Arginine vasopressin V2 receptor VPGHPSLPSCAWASLSAQP |
External Links | |
GenBank ID Protein | 862508 |
UniProtKB/Swiss-Prot ID | Q16271 |
UniProtKB/Swiss-Prot Entry Name | Q16271_HUMAN |
PDB IDs | Not Available |
GenBank Gene ID | S75754 |
GeneCard ID | Not Available |
GenAtlas ID | Not Available |
HGNC ID | Not Available |
References | |
General References |
|