Hmdb loader
Survey
You are using an unsupported browser. Please upgrade your browser to a newer version to get the best experience on Human Metabolome Database.
Identification
HMDB Protein ID HMDBP10831
Secondary Accession Numbers
  • 17118
Name Arginine vasopressin V2 receptor
Synonyms Not Available
Gene Name Not Available
Protein Type Unknown
Biological Properties
General Function Involved in receptor activity
Specific Function Not Available
Pathways Not Available
Reactions Not Available
GO Classification Not Available
Cellular Location Not Available
Gene Properties
Chromosome Location Not Available
Locus Not Available
SNPs Not Available
Gene Sequence
>57 bp
GTGCCTGGGCATCCCTCTCTGCCCAGCTGTGCCTGGGCATCCCTCTCTGCCCAGCCT
Protein Properties
Number of Residues 19
Molecular Weight 1905.1
Theoretical pI 7.36
Pfam Domain Function Not Available
Signals
  • None
Transmembrane Regions
  • None
Protein Sequence
>Arginine vasopressin V2 receptor
VPGHPSLPSCAWASLSAQP
GenBank ID Protein 862508
UniProtKB/Swiss-Prot ID Q16271
UniProtKB/Swiss-Prot Entry Name Q16271_HUMAN
PDB IDs Not Available
GenBank Gene ID S75754
GeneCard ID Not Available
GenAtlas ID Not Available
HGNC ID Not Available
References
General References
  1. Holtzman EJ, Kolakowski LF Jr, Geifman-Holtzman O, O'Brien DG, Rasoulpour M, Guillot AP, Ausiello DA: Mutations in the vasopressin V2 receptor gene in two families with nephrogenic diabetes insipidus. J Am Soc Nephrol. 1994 Aug;5(2):169-76. [PubMed:7993996 ]