Hmdb loader
Identification
HMDB Protein ID HMDBP10888
Secondary Accession Numbers
  • 17187
Name Metallothionein-1H
Synonyms
  1. MT-0
  2. MT-1H
  3. MT-IH
  4. Metallothionein-0
  5. Metallothionein-IH
Gene Name MT1H
Protein Type Unknown
Biological Properties
General Function Involved in metal ion binding
Specific Function Metallothioneins have a high content of cysteine residues that bind various heavy metals; these proteins are transcriptionally regulated by both heavy metals and glucocorticoids
Pathways Not Available
Reactions Not Available
GO Classification
Function
ion binding
cation binding
metal ion binding
binding
Cellular Location Not Available
Gene Properties
Chromosome Location Chromosome:1
Locus 16q13
SNPs MT1H
Gene Sequence
>186 bp
ATGGACCCCAACTGCTCCTGCGAGGCTGGTGGCTCCTGCGCCTGCGCCGGCTCCTGCAAG
TGCAAGAAGTGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGTTGCCCCCTGGGC
TGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGCGTCAGAGAAGTGCAGCTGCTGT
GCCTGA
Protein Properties
Number of Residues 61
Molecular Weight 6039.1
Theoretical pI 8.1
Pfam Domain Function
Signals
  • None
Transmembrane Regions
  • None
Protein Sequence
>Metallothionein-1H
MDPNCSCEAGGSCACAGSCKCKKCKCTSCKKSCCSCCPLGCAKCAQGCICKGASEKCSCC
A
GenBank ID Protein 14250024
UniProtKB/Swiss-Prot ID P80294
UniProtKB/Swiss-Prot Entry Name MT1H_HUMAN
PDB IDs Not Available
GenBank Gene ID BC008408
GeneCard ID MT1H
GenAtlas ID MT1H
HGNC ID HGNC:7400
References
General References
  1. Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG, Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI, Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C, Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T, Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB, Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K, Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T, Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH, Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC, Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL, Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M, Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S, Malek J: The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 2004 Oct;14(10B):2121-7. [PubMed:15489334 ]
  2. Pauwels M, van Weyenbergh J, Soumillion A, Proost P, De Ley M: Induction by zinc of specific metallothionein isoforms in human monocytes. Eur J Biochem. 1994 Feb 15;220(1):105-10. [PubMed:8119276 ]
  3. Soumillion A, Van Damme J, De Ley M: Cloning and specific polymerised-chain-reaction amplification of a third charge-separable human metallothionein isoform. Eur J Biochem. 1992 Nov 1;209(3):999-1004. [PubMed:1425708 ]
  4. Stennard FA, Holloway AF, Hamilton J, West AK: Characterisation of six additional human metallothionein genes. Biochim Biophys Acta. 1994 Aug 2;1218(3):357-65. [PubMed:8049263 ]